chrovis/varity issues and pull requests

#110 - Fix frameshift processing order

Pull Request - State: closed - Opened by nokara26 about 1 month ago

#109 - Support uncertain base and amino acid

Pull Request - State: closed - Opened by nokara26 about 1 month ago

#108 - NullPointerException case in vcf-variant->hgvs

Pull Request - State: closed - Opened by nokara26 about 1 month ago

#107 - NullPointerException case in vcf-variant->hgvs

Issue - State: closed - Opened by federkasten about 1 month ago
Labels: bug

#106 - Fix the dispatcher to check if an arg extends the varity.ref_gene.GeneAnnotationIndex protocol

Pull Request - State: closed - Opened by federkasten about 2 months ago

#105 - fix read-seq-info and termination site variant condition

Pull Request - State: closed - Opened by nokara26 2 months ago

#104 - add utr variant determine process

Pull Request - State: open - Opened by nokara26 3 months ago

#103 - fix: fix apply-offset for first exon variant

Pull Request - State: closed - Opened by nokara26 5 months ago

#102 - Introduce `GeneAnnotationIndex` as an abstraction of `RefGeneIndex`

Pull Request - State: closed - Opened by k-kom 5 months ago

#101 - Add prefer-extension option for variant affects initial codon

Pull Request - State: closed - Opened by nokara26 6 months ago

#100 - Fix initiation codon in protein-frameshift and protein-extension

Pull Request - State: closed - Opened by nokara26 6 months ago

#99 - Add extension conditional branch and fix protein-extension

Pull Request - State: closed - Opened by nokara26 6 months ago

#98 - Add no-effect branch to protein type determine process

Pull Request - State: closed - Opened by nokara26 6 months ago

#97 - Fix vcf-to-hgvs protein to handle initiation or stop codon variant more precisely

Issue - State: closed - Opened by nokara26 7 months ago - 1 comment

#96 - Failed to convert long deletion including stop codon chr17:80090386 CAGCACGTGCATGAACAACACAGGACACACACAGCACGTGCATGAACAACACAGGACACACACA>C

Pull Request - State: closed - Opened by nokara26 7 months ago

#95 - Failed to convert long deletion including stop codon chr17:80090386 CAGCACGTGCATGAACAACACAGGACACACACAGCACGTGCATGAACAACACAGGACACACACA>C

Issue - State: closed - Opened by federkasten 8 months ago - 1 comment
Labels: bug

#93 - Refactor and generalize overlap-exon-intron-boundary?

Pull Request - State: closed - Opened by federkasten 10 months ago - 1 comment

#92 - Fix exon/intron boundary determine process and frameshift that affects initiation site

Pull Request - State: closed - Opened by nokara26 10 months ago - 1 comment

#91 - Prepare for next development iteration (0.11.1-SNAPSHOT)

Pull Request - State: closed - Opened by totakke 10 months ago

#90 - Release v0.11.0

Pull Request - State: closed - Opened by nokara26 10 months ago - 1 comment

#89 - Return protein-hgvs nil when variant overlaps exon/intron boundaries

Pull Request - State: closed - Opened by nokara26 10 months ago - 1 comment

#88 - Prepare for next development iteration (0.10.2-SNAPSHOT)

Pull Request - State: closed - Opened by totakke 10 months ago

#87 - Release 0.10.1

Pull Request - State: closed - Opened by nokara26 10 months ago - 1 comment

#86 - Incorrect translation for unaffected stop codon

Pull Request - State: closed - Opened by nokara26 10 months ago - 1 comment

#85 - Prepare for next development iteration (0.10.1-SNAPSHOT)

Pull Request - State: closed - Opened by totakke 11 months ago - 1 comment

#84 - Release 0.10.0

Pull Request - State: closed - Opened by nokara26 11 months ago - 3 comments

#83 - Incorrect translation for unaffected stop codon

Issue - State: closed - Opened by federkasten 12 months ago
Labels: bug

#82 - Fix boundary of exon/intron determining process

Pull Request - State: closed - Opened by nokara26 about 1 year ago - 1 comment

#81 - Fix upstream and downstream sequence of sequence-info and delins process

Pull Request - State: closed - Opened by nokara26 about 1 year ago - 1 comment

#80 - Fix upstream and downstream sequence of sequence-info and tweak frameshift process

Pull Request - State: closed - Opened by nokara26 about 1 year ago - 2 comments

#79 - Prepare for next development iteration (0.9.4-SNAPSHOT)

Pull Request - State: closed - Opened by nokara26 over 1 year ago

#78 - Release 0.9.3

Pull Request - State: closed - Opened by nokara26 over 1 year ago - 1 comment

#77 - fix overlapping condition of boundary of exon/intron

Pull Request - State: closed - Opened by nokara26 over 1 year ago - 1 comment

#76 - Upgrade actions

Pull Request - State: closed - Opened by federkasten over 1 year ago - 1 comment

#75 - Fix 3'-rule errors for certain sequence patterns

Pull Request - State: closed - Opened by federkasten over 1 year ago - 1 comment

#74 - Out of position when converting vcf to hgvs

Issue - State: closed - Opened by nokara26 over 1 year ago - 1 comment

#73 - add out of position test case

Pull Request - State: closed - Opened by nokara26 over 1 year ago - 1 comment

#72 - StringIndexOutOfBoundsException in apply-3'-rule

Issue - State: closed - Opened by nokara26 over 1 year ago

#71 - Protein StringIndexOutOfBoundsException occurred

Pull Request - State: closed - Opened by nokara26 over 1 year ago - 1 comment

#70 - Prepare for next development iteration (0.9.3-SNAPSHOT)

Pull Request - State: closed - Opened by nokara26 almost 2 years ago

#69 - Release 0.9.2

Pull Request - State: closed - Opened by nokara26 almost 2 years ago - 2 comments

#68 - Fix VCF to protein HGVS conversions of insertions near splice sites

Pull Request - State: closed - Opened by alumi almost 2 years ago - 2 comments
Labels: bug

#67 - test: add repeat insertion test

Pull Request - State: closed - Opened by nokara26 almost 2 years ago

#66 - Fix the position of first amino acid changed by the frame shift

Pull Request - State: closed - Opened by nokara26 about 2 years ago - 1 comment

#65 - fix conditional branch of frameshift caused by insertion

Pull Request - State: closed - Opened by nokara26 about 2 years ago - 1 comment

#64 - Release 0.9.1

Pull Request - State: closed - Opened by totakke about 2 years ago

#63 - Fix the 3’ rule on a trailing sub-sequence

Pull Request - State: closed - Opened by totakke about 2 years ago - 1 comment

#62 - test: add deletion test case.

Pull Request - State: closed - Opened by nokara26 about 2 years ago - 1 comment

#61 - Feature to filter out refgene index source

Pull Request - State: closed - Opened by k-kom about 2 years ago - 1 comment

#60 - Fix to avoid null pointer exception when `cljam.io.sequence/read-sequence` returns nil

Pull Request - State: closed - Opened by k-kom over 2 years ago - 1 comment

#59 - Fix frameshift conversion failure

Pull Request - State: closed - Opened by totakke over 2 years ago - 1 comment

#58 - `vcf-variants->hgvs` omits trailing `fs*`

Issue - State: closed - Opened by k-kom over 2 years ago - 1 comment
Labels: question

#57 - Add genomic GTF reader

Pull Request - State: closed - Opened by nokara26 over 2 years ago - 2 comments

#56 - Change the default :prefer-deletion? to false

Pull Request - State: closed - Opened by totakke over 2 years ago - 1 comment

#55 - Tweak GENCODE loading performance

Pull Request - State: closed - Opened by federkasten over 2 years ago - 1 comment

#54 - Update codecov-action to v3

Pull Request - State: closed - Opened by totakke over 2 years ago

#53 - Bump up snapshot version to 0.9.0-SNAPSHOT

Pull Request - State: closed - Opened by totakke over 2 years ago

#52 - Annotate fusion genes

Pull Request - State: closed - Opened by alumi over 2 years ago - 2 comments
Labels: enhancement

#51 - Fix gencode file loading

Pull Request - State: closed - Opened by k-kom over 2 years ago - 1 comment

#50 - Fix alt exon calculation for deletion

Pull Request - State: closed - Opened by totakke over 2 years ago - 1 comment

#49 - Convert ATM c.2465del correctly

Issue - State: closed - Opened by federkasten over 2 years ago

#48 - fix: logging liftover failure caused by different refs

Pull Request - State: closed - Opened by nuggetoriniku over 2 years ago - 1 comment

#47 - Fix the peformance of liftover-variants.

Pull Request - State: closed - Opened by niyarin about 3 years ago - 7 comments

#46 - Release 0.8.0

Pull Request - State: closed - Opened by k-kom about 3 years ago

#45 - feat: conversion from/to hgvs with GENCODE ID

Pull Request - State: closed - Opened by k-kom about 3 years ago - 3 comments

#44 - Lookup index by GENCODE

Pull Request - State: closed - Opened by k-kom about 3 years ago - 3 comments

#43 - feat: compat with acession number with version

Pull Request - State: closed - Opened by k-kom about 3 years ago - 3 comments

#42 - Compatible with GENCODE's GTF and GFF3 format

Pull Request - State: closed - Opened by k-kom about 3 years ago - 1 comment

#41 - Use GitHub Actions

Pull Request - State: closed - Opened by totakke over 3 years ago - 1 comment

#40 - Fix reference protein seq in fs-ter-substitution

Pull Request - State: closed - Opened by itoooo over 3 years ago - 3 comments

#39 - Don't work hgvs->vcf-variants in some case

Issue - State: closed - Opened by kbaba1001 over 3 years ago - 3 comments

#38 - changed the return format: vector->map

Pull Request - State: closed - Opened by nuggetoriniku almost 4 years ago - 2 comments

#37 - Error handling in conversion of an invalid coordinate

Pull Request - State: closed - Opened by totakke almost 4 years ago - 2 comments

#36 - Seek intron, 3'-UTR, and 5'-UTR regions from genomic position

Pull Request - State: closed - Opened by nuggetoriniku over 4 years ago - 6 comments

#35 - Add support for vcf lift-over.

Pull Request - State: closed - Opened by niyarin over 4 years ago - 11 comments
Labels: enhancement

#34 - Upgrade clj-hgvs and fix cds-start/cds-end handling in vcf-to-hgvs

Pull Request - State: closed - Opened by federkasten over 4 years ago - 1 comment

#33 - Add function for finding alternative HGVS expressions

Pull Request - State: closed - Opened by totakke almost 5 years ago - 1 comment

#32 - Add prefer-insertion? option to VCF->HGVS

Pull Request - State: closed - Opened by totakke almost 5 years ago - 1 comment

#31 - Support conversion from repeated sequences to VCF deletion

Pull Request - State: closed - Opened by totakke almost 5 years ago - 1 comment

#30 - Support repeated sequences caused by deletion on VCF->HGVS

Pull Request - State: closed - Opened by totakke almost 5 years ago - 1 comment

#29 - Fix conversion from reverse-strand repeated sequences to VCF variant

Pull Request - State: closed - Opened by totakke almost 5 years ago - 1 comment
Labels: bug

#28 - Rename cdna to coding-dna

Pull Request - State: closed - Opened by totakke over 5 years ago - 3 comments

#27 - Throw ex-info on hgvs->vcf for a variant containing ambiguous coordinates

Pull Request - State: closed - Opened by totakke over 5 years ago - 1 comment

#26 - Include MNVs in protein HGVS -> VCF conversion results

Pull Request - State: closed - Opened by alumi over 5 years ago - 3 comments

#25 - Remove incorrect VCF variants from protein HGVS to VCF variants conversion results

Pull Request - State: closed - Opened by alumi over 5 years ago - 2 comments
Labels: bug

#24 - Fix pos of hgvs->vcf-variants for genes on reverse strand

Pull Request - State: closed - Opened by alumi almost 6 years ago - 3 comments
Labels: bug

#23 - Update clj-hgvs and proton

Pull Request - State: closed - Opened by totakke almost 6 years ago - 1 comment